← Back

Example Report: NF1 (Neurofibromatosis Type 1)

This is an example of the ASO design report you receive. The patient carries a pathogenic variant in NF1 (c.4515+1G>A, affecting exon 31 splice donor). The platform identified exon-skipping as the optimal mechanism and designed 5 candidate antisense oligonucleotides ranked by predicted efficacy.

This is a real output from the Pequliar design engine. The sequences, thermodynamic parameters, and off-target analysis shown below are what a paying customer receives for their specific gene and variant.

We analyzed NF1 and designed an antisense oligonucleotide sequence targeting exon skipping.

ASOs are short synthetic nucleic acid molecules with a proven mechanism of action. Several ASO drugs are already approved and treating patients worldwide — including Spinraza for spinal muscular atrophy and Eteplirsen for Duchenne muscular dystrophy.

This is computational scientific advice based on cutting-edge research. It is not a drug, not FDA-approved, and not a substitute for medical supervision.

If you or your child is living with a life-threatening genetic condition with no approved treatment, you have the right to explore experimental approaches — provided you do your best to establish safety, do not endanger the patient, and act with the sole intent of helping them.

exon skipping2′-MOE phosphorothioate

NM_000267.3 · 12,427 nt · 58 exons · 847 evaluated → 5 selected

Lead Candidate

GCTTCAGACTGATCCTGGAAC

21 ntGC 52.4%Tm 62.3°CΔG -38.7 kcal/molP(hyb) 94%Kd 0.80 nMScore 92%
ΔGopen -6.2 kcal/molAccessibility 71%ΔΔGcompete -4.1
#SequencePositionGC%TmMFEOpenAccKdScoreSiteBLAST
1GCTTCAGACTGATCCTGGAAC4872489252%62.3-38.7-6.271%0.8092%Clean
2AGTCCTTGACAGCTGAATCG4855487450%60.1-35.4-5.867%188%Clean
3CTGGATCAAGTCCTGCTTAG4899491850%59.8-34.9-5.463%285%1 off-target
4TAGCCTGAACTTGCTGATCCA4840486048%58.6-33.2-4.959%281%Clean
5ACCTGATCGAGTCAGCTTGA4920493950%59.2-32.8-4.656%278%2 off-targets

What This Means & What To Do Next

This ASO masks a mutated exon so cells skip over it during mRNA processing, producing a shorter but partially functional protein — the same approach used by Eteplirsen (Exondys 51).

  1. Share this report with a molecular biologist, geneticist, or physician familiar with nucleic acid therapeutics.
  2. Order synthesis of the lead candidate from an oligonucleotide provider (e.g., IDT, Eurogentec, Ajinomoto Bio-Pharma). Specify the chemistry noted above (2′-MOE phosphorothioate).
  3. Perform cell-based testing (e.g., patient-derived fibroblasts or iPSCs) to verify target engagement and rule out cytotoxicity.
  4. Only proceed to animal or human use under professional medical guidance and with adequate safety data.

ASO drugs already approved: Spinraza (SMA), Eteplirsen/Golodirsen/Viltolarsen (DMD), Inotersen (hATTR), Tofersen (ALS/SOD1), Casimersen (DMD), Mipomersen (hypercholesterolemia).

You assume full responsibility for any decision to pursue this beyond computational advice. This report does not constitute medical advice, drug prescription, or a claim of therapeutic efficacy.

Intellectual Property

The antisense oligonucleotide sequences in this report belong entirely to you, the purchaser. Pequliar does not claim any ownership, license, or rights over the sequences designed for your gene. You are free to use, synthesize, modify, patent, or share them without restriction or royalty.

These sequences were generated computationally for your specific mutation. They have not been previously published or patented. You may wish to protect them with a provisional patent application.

Protect your sequences with a provisional patent

A U.S. provisional patent application establishes a priority date and gives you 12 months of “patent pending” protection. We can draft and file it for you, listing you (or your child) as inventor.

Coming Soon
Get Your Report

$399 per gene · Results in minutes